Home

Convertit croazieră Gigant table primer sequence genă plutitor Vulcan

The primer sequences for qRT-PCR. | Download Table
The primer sequences for qRT-PCR. | Download Table

PPT - Supplementary Table 1 Sequences of quantative RT-PCR primers PowerPoint Presentation - ID:5610790
PPT - Supplementary Table 1 Sequences of quantative RT-PCR primers PowerPoint Presentation - ID:5610790

View Image
View Image

Scientific Protocols - SARS PCR/Sequencing Primers
Scientific Protocols - SARS PCR/Sequencing Primers

View Image
View Image

View Image
View Image

Table S1. List of primers used in study. Name of Primer Sequence of
Table S1. List of primers used in study. Name of Primer Sequence of

Tables_Page_1.jpg
Tables_Page_1.jpg

Table 2. Primer sequences and PCR protocol used for the RT-PCR assay : Benzoin Thiosemicarbazone Inhibits Growth and Triggers Apoptosis in Earlich Ascites Carcinoma Cells through an Intrinsic Pathway : Science and
Table 2. Primer sequences and PCR protocol used for the RT-PCR assay : Benzoin Thiosemicarbazone Inhibits Growth and Triggers Apoptosis in Earlich Ascites Carcinoma Cells through an Intrinsic Pathway : Science and

JCI Insight - Brd4-p300 inhibition downregulates Nox4 and accelerates lung fibrosis resolution in aged mice
JCI Insight - Brd4-p300 inhibition downregulates Nox4 and accelerates lung fibrosis resolution in aged mice

View Image
View Image

Primer Sequence for Quantitative PCR | Download Table
Primer Sequence for Quantitative PCR | Download Table

JCI - E-cadherin expression on multiple myeloma cells activates tumor-promoting properties in plasmacytoid DCs
JCI - E-cadherin expression on multiple myeloma cells activates tumor-promoting properties in plasmacytoid DCs

Table of RT-PCR primer sequences | Download Table
Table of RT-PCR primer sequences | Download Table

Supplementary Table 3 PCR primer sequences for qPCR Gene symbol (human) Forward primer sequences (5'-3') Reverse primer sequence
Supplementary Table 3 PCR primer sequences for qPCR Gene symbol (human) Forward primer sequences (5'-3') Reverse primer sequence

View Image
View Image

PPT - Supplementary Table 2: Primers for constructing and sequencing pFex. PowerPoint Presentation - ID:4582870
PPT - Supplementary Table 2: Primers for constructing and sequencing pFex. PowerPoint Presentation - ID:4582870

Supplementary Table 1: primer sequences - ppt download
Supplementary Table 1: primer sequences - ppt download

Khilko-2018. Nice paper. | by Eli Lyons | Medium
Khilko-2018. Nice paper. | by Eli Lyons | Medium

Table S2. Primer Sequences
Table S2. Primer Sequences

RT-PCR PRIMER SEQUENCES. | Download Table
RT-PCR PRIMER SEQUENCES. | Download Table

Table 1 from Guelph Guelph , ON , Canada Single-Primer Amplification of Flanking Sequences | Semantic Scholar
Table 1 from Guelph Guelph , ON , Canada Single-Primer Amplification of Flanking Sequences | Semantic Scholar

P. Azad et al. 1 SI Table S1 Primer sequences of genes tested by
P. Azad et al. 1 SI Table S1 Primer sequences of genes tested by

Yamanaka, Mol Vis 2006; 12:841-851. Table 2.
Yamanaka, Mol Vis 2006; 12:841-851. Table 2.

Table of primers a Primer name Base position b Sequence 533 | Download Table
Table of primers a Primer name Base position b Sequence 533 | Download Table

View Image
View Image

Table S3. Primers Used for SURVEYOR Assays, Related to Experimental Procedures primer name genomic target primer sequence (5'
Table S3. Primers Used for SURVEYOR Assays, Related to Experimental Procedures primer name genomic target primer sequence (5'

Supplementary Table 2: Primer sequences and DHPLC conditions
Supplementary Table 2: Primer sequences and DHPLC conditions

Tables_Page_1.jpg
Tables_Page_1.jpg

Table SI. Primer sequences for RT‑qPCR. Product Forward primer sequence Reverse primer sequence IL‑6 GAGGATACCACTCCCAACAGACC
Table SI. Primer sequences for RT‑qPCR. Product Forward primer sequence Reverse primer sequence IL‑6 GAGGATACCACTCCCAACAGACC